ID: 1053033903_1053033911

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1053033903 1053033911
Species Human (GRCh38) Human (GRCh38)
Location 9:34808629-34808651 9:34808680-34808702
Sequence CCTGGTCTCTACTTCCAAGATGG GGGGAATGCTGTTTTTCACATGG
Strand - +
Off-target summary {0: 4, 1: 37, 2: 124, 3: 178, 4: 357} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!