ID: 1053040131_1053040141

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1053040131 1053040141
Species Human (GRCh38) Human (GRCh38)
Location 9:34863146-34863168 9:34863197-34863219
Sequence CCAGGGTCTGGCTCCTGGGCAGT AACTTGACACCCTGAAGGGAAGG
Strand - +
Off-target summary No data {0: 4, 1: 24, 2: 94, 3: 200, 4: 464}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!