ID: 1053050404_1053050410

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1053050404 1053050410
Species Human (GRCh38) Human (GRCh38)
Location 9:34957482-34957504 9:34957517-34957539
Sequence CCCTCAGAATTGCTGGCCTTCTG TTTGGATATTGTGAGGGATGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 8, 3: 161, 4: 1852}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!