ID: 1053052212_1053052217

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1053052212 1053052217
Species Human (GRCh38) Human (GRCh38)
Location 9:34971427-34971449 9:34971448-34971470
Sequence CCGCCGTGGCACTGTAGAGGGCT CTCCGTCCAGGAGGTACAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 71} {0: 1, 1: 0, 2: 1, 3: 6, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!