ID: 1053072022_1053072026

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1053072022 1053072026
Species Human (GRCh38) Human (GRCh38)
Location 9:35107417-35107439 9:35107443-35107465
Sequence CCAGAAGGGTGTGGCTTTGGCAT AACTGTTGGCAGCAGTAGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 164} {0: 1, 1: 1, 2: 3, 3: 18, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!