ID: 1053103407_1053103424

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1053103407 1053103424
Species Human (GRCh38) Human (GRCh38)
Location 9:35390407-35390429 9:35390456-35390478
Sequence CCCCAGGCCCATCTTGCCTATGG GCCACTGGCCCCTGGCCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 179} {0: 1, 1: 0, 2: 4, 3: 83, 4: 419}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!