ID: 1053125312_1053125316

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1053125312 1053125316
Species Human (GRCh38) Human (GRCh38)
Location 9:35576208-35576230 9:35576227-35576249
Sequence CCCTCATTGGCTGAAACAGGCAC GCACTCTGGGTTTCCAGCATTGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 2, 3: 16, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!