ID: 1053140843_1053140850

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1053140843 1053140850
Species Human (GRCh38) Human (GRCh38)
Location 9:35681906-35681928 9:35681938-35681960
Sequence CCCCTGAAAAGGAAGTCCCAATG GACCCAGGCCCTGCTCATTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 162} {0: 1, 1: 0, 2: 0, 3: 16, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!