ID: 1053143877_1053143884

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1053143877 1053143884
Species Human (GRCh38) Human (GRCh38)
Location 9:35698994-35699016 9:35699025-35699047
Sequence CCATGGTGAGGGTGGAAGAGGAA GACTGACCTTGGGTTTGGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 42, 4: 375} {0: 1, 1: 0, 2: 1, 3: 12, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!