ID: 1053151748_1053151756

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1053151748 1053151756
Species Human (GRCh38) Human (GRCh38)
Location 9:35748273-35748295 9:35748313-35748335
Sequence CCCACCTCTGCTAGAAGTTTTGA CCAAAGGCATTCTAGGCAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 170} {0: 1, 1: 0, 2: 2, 3: 15, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!