ID: 1053155720_1053155729

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1053155720 1053155729
Species Human (GRCh38) Human (GRCh38)
Location 9:35777377-35777399 9:35777423-35777445
Sequence CCTCAGCCTCCCAAAGTGCTGGG CAGGCCTAAATCATGTTTTGTGG
Strand - +
Off-target summary {0: 84188, 1: 205795, 2: 234195, 3: 260821, 4: 298692} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!