ID: 1053160262_1053160265

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1053160262 1053160265
Species Human (GRCh38) Human (GRCh38)
Location 9:35809192-35809214 9:35809208-35809230
Sequence CCCTAGATGAGCTAGGATGCTTC ATGCTTCCAGCTAGAGCTTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 68} {0: 1, 1: 0, 2: 1, 3: 10, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!