ID: 1053168943_1053168952

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1053168943 1053168952
Species Human (GRCh38) Human (GRCh38)
Location 9:35864775-35864797 9:35864803-35864825
Sequence CCTACTGGCCATGGCCTAAATGT GGGAGCTGGAGCCAGGTGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 121} {0: 1, 1: 2, 2: 6, 3: 145, 4: 1316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!