ID: 1053168945_1053168950

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1053168945 1053168950
Species Human (GRCh38) Human (GRCh38)
Location 9:35864783-35864805 9:35864801-35864823
Sequence CCATGGCCTAAATGTCTGTAGGG TAGGGAGCTGGAGCCAGGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 96} {0: 1, 1: 0, 2: 4, 3: 40, 4: 481}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!