ID: 1053181215_1053181228

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1053181215 1053181228
Species Human (GRCh38) Human (GRCh38)
Location 9:35972136-35972158 9:35972182-35972204
Sequence CCCAAAACCTTCGTTGCGATGAC CCGCCGATGTGAGGCCGCCCGGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 1, 3: 1, 4: 25} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!