ID: 1053231609_1053231615

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1053231609 1053231615
Species Human (GRCh38) Human (GRCh38)
Location 9:36415156-36415178 9:36415203-36415225
Sequence CCCTTCTTCCTCAACAACACCAA CATAATCTCAAACTTATTGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 46, 4: 394} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!