ID: 1053249103_1053249106

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1053249103 1053249106
Species Human (GRCh38) Human (GRCh38)
Location 9:36559739-36559761 9:36559754-36559776
Sequence CCCTCTTAGTTATGTGCTTTCTG GCTTTCTGTTCTCTTGGTTAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 19, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!