ID: 1053283774_1053283785

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1053283774 1053283785
Species Human (GRCh38) Human (GRCh38)
Location 9:36837910-36837932 9:36837955-36837977
Sequence CCCAACAGCCTGGAACCACAAGG GTACACATCATTCCAAAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 181} {0: 1, 1: 0, 2: 1, 3: 5, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!