ID: 1053387800_1053387803

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1053387800 1053387803
Species Human (GRCh38) Human (GRCh38)
Location 9:37708439-37708461 9:37708457-37708479
Sequence CCTCCAAATGAACAATGAGCCTG GCCTGCTGAAGACCTTTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 135} {0: 1, 1: 0, 2: 5, 3: 18, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!