ID: 1053387800_1053387808

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1053387800 1053387808
Species Human (GRCh38) Human (GRCh38)
Location 9:37708439-37708461 9:37708490-37708512
Sequence CCTCCAAATGAACAATGAGCCTG CGATATTCTCAGGTACTAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 135} {0: 1, 1: 0, 2: 0, 3: 4, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!