ID: 1053397455_1053397461

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1053397455 1053397461
Species Human (GRCh38) Human (GRCh38)
Location 9:37787308-37787330 9:37787349-37787371
Sequence CCTAGGCGGCGGGAGCCCTAGGC ACCCGGCTTCAAGCCGTCGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 145} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!