ID: 1053414923_1053414928

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1053414923 1053414928
Species Human (GRCh38) Human (GRCh38)
Location 9:37941486-37941508 9:37941500-37941522
Sequence CCGCTGTGCAGAGCTCCCTCTGT TCCCTCTGTTGGGGGAGTCATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 41, 4: 340} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!