ID: 1053478023_1053478028

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1053478023 1053478028
Species Human (GRCh38) Human (GRCh38)
Location 9:38396030-38396052 9:38396051-38396073
Sequence CCGGATGGATGCCTCTGAGCGGG GGGCCGGCTGCTGAACCGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 100} {0: 2, 1: 0, 2: 0, 3: 10, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!