ID: 1053478240_1053478252

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1053478240 1053478252
Species Human (GRCh38) Human (GRCh38)
Location 9:38397163-38397185 9:38397203-38397225
Sequence CCTACAACATCGTCACCTGCCAC TAAGGAATCTGGAAACGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 17, 4: 120} {0: 1, 1: 0, 2: 1, 3: 13, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!