ID: 1053478240_1053478254

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1053478240 1053478254
Species Human (GRCh38) Human (GRCh38)
Location 9:38397163-38397185 9:38397210-38397232
Sequence CCTACAACATCGTCACCTGCCAC TCTGGAAACGGGAGGGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 17, 4: 120} {0: 1, 1: 2, 2: 2, 3: 14, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!