ID: 1053480640_1053480651

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1053480640 1053480651
Species Human (GRCh38) Human (GRCh38)
Location 9:38414150-38414172 9:38414192-38414214
Sequence CCTGCGCCCCGGTGACGTTGTGA CGACCACAGGAGCTAGGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 38} {0: 1, 1: 0, 2: 2, 3: 16, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!