ID: 1053488259_1053488272

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1053488259 1053488272
Species Human (GRCh38) Human (GRCh38)
Location 9:38478421-38478443 9:38478461-38478483
Sequence CCCACTTCCCCTTGCCAGCGGGC TGCCGGAGCCACGGAGGATGAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 29, 4: 607}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!