ID: 1053598337_1053598344

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1053598337 1053598344
Species Human (GRCh38) Human (GRCh38)
Location 9:39585755-39585777 9:39585775-39585797
Sequence CCCTTTATCCTGAACATCAGCAG CAGGTGGGCCCAGGACTACCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 11, 4: 223} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!