ID: 1053599349_1053599355

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1053599349 1053599355
Species Human (GRCh38) Human (GRCh38)
Location 9:39594293-39594315 9:39594320-39594342
Sequence CCAAACAACCAAATCAGCTGTAA CTGTTGGTATGGAGGACAGAAGG
Strand - +
Off-target summary No data {0: 2, 1: 2, 2: 1, 3: 18, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!