ID: 1053610815_1053610818

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1053610815 1053610818
Species Human (GRCh38) Human (GRCh38)
Location 9:39711399-39711421 9:39711426-39711448
Sequence CCTGCCATCTTCTGTGAATAACT TCCTTTTGAGAAACAACTCTTGG
Strand - +
Off-target summary No data {0: 6, 1: 30, 2: 252, 3: 273, 4: 455}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!