ID: 1053656378_1053656384

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1053656378 1053656384
Species Human (GRCh38) Human (GRCh38)
Location 9:40221961-40221983 9:40221985-40222007
Sequence CCCATCCCAGTTCCACAGAGAAC CAACCACTATGGCCCCTGAGCGG
Strand - +
Off-target summary {0: 5, 1: 0, 2: 1, 3: 16, 4: 209} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!