ID: 1053664339_1053664346

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1053664339 1053664346
Species Human (GRCh38) Human (GRCh38)
Location 9:40307107-40307129 9:40307136-40307158
Sequence CCCTGTAGTTCCAGCTCCAGCCA AAAGATGCACAGGTACAGCTTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 16, 3: 85, 4: 448} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!