ID: 1053695909_1053695922

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1053695909 1053695922
Species Human (GRCh38) Human (GRCh38)
Location 9:40639171-40639193 9:40639223-40639245
Sequence CCAGGCCCTAGTCCTCCCTTCCT GAGGTCATCAGTGCAGGCCATGG
Strand - +
Off-target summary No data {0: 6, 1: 10, 2: 13, 3: 81, 4: 356}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!