ID: 1053695911_1053695922

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1053695911 1053695922
Species Human (GRCh38) Human (GRCh38)
Location 9:40639177-40639199 9:40639223-40639245
Sequence CCTAGTCCTCCCTTCCTGTGTCA GAGGTCATCAGTGCAGGCCATGG
Strand - +
Off-target summary No data {0: 6, 1: 10, 2: 13, 3: 81, 4: 356}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!