ID: 1053733121_1053733129

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1053733121 1053733129
Species Human (GRCh38) Human (GRCh38)
Location 9:41076694-41076716 9:41076747-41076769
Sequence CCTACAGGTACATGCCACCACGC GGGGTTTCACCATGTTGCCTAGG
Strand - +
Off-target summary {0: 4, 1: 18, 2: 148, 3: 360, 4: 737} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!