ID: 1053785693_1053785702

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1053785693 1053785702
Species Human (GRCh38) Human (GRCh38)
Location 9:41651060-41651082 9:41651112-41651134
Sequence CCCTGAGCTCTATTTACCCTTTT TCTCCTAGCTGGTTTCCTAGAGG
Strand - +
Off-target summary {0: 7, 1: 0, 2: 0, 3: 16, 4: 239} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!