ID: 1053856370_1053856377

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1053856370 1053856377
Species Human (GRCh38) Human (GRCh38)
Location 9:42342764-42342786 9:42342784-42342806
Sequence CCCTTTATCCTGAACATCAGCAG CAGGTGGGCCCAGGACTACCAGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 3, 3: 20, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!