ID: 1053907633_1053907639

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1053907633 1053907639
Species Human (GRCh38) Human (GRCh38)
Location 9:42859816-42859838 9:42859862-42859884
Sequence CCTGACACCATTGATAGAAGTGA GAGGAAACTGCCACCTGTATTGG
Strand - +
Off-target summary {0: 8, 1: 4, 2: 4, 3: 35, 4: 414} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!