ID: 1053942886_1053942891

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1053942886 1053942891
Species Human (GRCh38) Human (GRCh38)
Location 9:43270134-43270156 9:43270171-43270193
Sequence CCTAGAAAGGGGCTGCAGTGCTT TGGGCGGTACCTGCCTATTGTGG
Strand - +
Off-target summary {0: 1, 1: 33, 2: 193, 3: 223, 4: 362} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!