ID: 1054098070_1054098081

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1054098070 1054098081
Species Human (GRCh38) Human (GRCh38)
Location 9:60919163-60919185 9:60919200-60919222
Sequence CCATCTTGGAATGATCATGAACC CAGCTGGACAGGAGGGCAGGTGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 2, 3: 9, 4: 95} {0: 9, 1: 0, 2: 12, 3: 110, 4: 776}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!