ID: 1054098073_1054098081

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1054098073 1054098081
Species Human (GRCh38) Human (GRCh38)
Location 9:60919185-60919207 9:60919200-60919222
Sequence CCTTGAAGCCTCCTCCAGCTGGA CAGCTGGACAGGAGGGCAGGTGG
Strand - +
Off-target summary {0: 5, 1: 0, 2: 9, 3: 28, 4: 244} {0: 9, 1: 0, 2: 12, 3: 110, 4: 776}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!