ID: 1054156347_1054156351

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1054156347 1054156351
Species Human (GRCh38) Human (GRCh38)
Location 9:61643448-61643470 9:61643467-61643489
Sequence CCTGGGGAAATAATGCCTGGGTC GGTCAAGTTAGGGAAGATCCAGG
Strand - +
Off-target summary {0: 5, 1: 3, 2: 1, 3: 11, 4: 137} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!