ID: 1054156462_1054156466

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1054156462 1054156466
Species Human (GRCh38) Human (GRCh38)
Location 9:61644318-61644340 9:61644340-61644362
Sequence CCTGCCTGTCCCAACTTGGGTTC CTACCCTGATCCCTTCCGACAGG
Strand - +
Off-target summary {0: 8, 1: 0, 2: 0, 3: 7, 4: 162} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!