ID: 1054162421_1054162427

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1054162421 1054162427
Species Human (GRCh38) Human (GRCh38)
Location 9:61683026-61683048 9:61683044-61683066
Sequence CCGAAGACCCCAGAGGCAGATGT GATGTCAGCAGAAAATGGCAGGG
Strand - +
Off-target summary {0: 5, 1: 4, 2: 8, 3: 45, 4: 367} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!