ID: 1054225232_1054225240

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1054225232 1054225240
Species Human (GRCh38) Human (GRCh38)
Location 9:62453914-62453936 9:62453940-62453962
Sequence CCAGGCATGGAGTAGTGGGCACC GAGGCTCAGGGTCCTGTGGGTGG
Strand - +
Off-target summary {0: 6, 1: 1, 2: 5, 3: 27, 4: 168} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!