ID: 1054282541_1054282544

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1054282541 1054282544
Species Human (GRCh38) Human (GRCh38)
Location 9:63138433-63138455 9:63138446-63138468
Sequence CCCTTGGCTGGGGTGGGGTCCTC TGGGGTCCTCTCTTTCCTGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 5, 2: 8, 3: 19, 4: 265}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!