ID: 1054286499_1054286503

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1054286499 1054286503
Species Human (GRCh38) Human (GRCh38)
Location 9:63179843-63179865 9:63179886-63179908
Sequence CCCCTCACCATTGAAAACACATT TCATTTCCACACAAAGAAGATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!