ID: 1054307161_1054307166

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1054307161 1054307166
Species Human (GRCh38) Human (GRCh38)
Location 9:63438405-63438427 9:63438435-63438457
Sequence CCTTCCTGTGTCAACTGCTCAAA CCCCATGAGGTCATCAGTGCAGG
Strand - +
Off-target summary {0: 12, 1: 4, 2: 3, 3: 32, 4: 497} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!