ID: 1054318327_1054318330

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1054318327 1054318330
Species Human (GRCh38) Human (GRCh38)
Location 9:63623724-63623746 9:63623767-63623789
Sequence CCTTATATTCTTAACAACAACAG TCTTTCTGCCCCATGCACCTAGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 1, 3: 10, 4: 211} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!