ID: 1054322498_1054322509

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1054322498 1054322509
Species Human (GRCh38) Human (GRCh38)
Location 9:63685349-63685371 9:63685400-63685422
Sequence CCTGCCTTCTGGCTGCTTTTGTG CAGGCACATGGTGTTGTTGGTGG
Strand - +
Off-target summary No data {0: 6, 1: 1, 2: 1, 3: 11, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!